Review



plasmid plko 1 puro scramble  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc plasmid plko 1 puro scramble
    Plasmid Plko 1 Puro Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1475 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pmc12978252-240-25-27?v=Addgene+inc
    Average 96 stars, based on 1475 article reviews
    plasmid plko 1 puro scramble - by Bioz Stars, 2026-07
    96/100 stars

    Images



    Similar Products

    96
    Addgene inc plasmid plko 1 puro scramble
    Plasmid Plko 1 Puro Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pmc12978252-240-25-27?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plasmid plko 1 puro scramble - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    93
    Addgene inc tet plko 1 puro scramble addgene
    Tet Plko 1 Puro Scramble Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pm41344331-297-227-228?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    tet plko 1 puro scramble addgene - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc tet plko 1 puro scramble
    Tet Plko 1 Puro Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pmc12709618-508-0-1?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    tet plko 1 puro scramble - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid tet plko 1 puro scramble
    Plasmid Tet Plko 1 Puro Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pmc12709618-1499-0-3?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    plasmid tet plko 1 puro scramble - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc tet plko 1 sh scramble cctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttagg
    Tet Plko 1 Sh Scramble Cctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttagg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pmc12709618-1516-0-3?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    tet plko 1 sh scramble cctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttagg - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 puro scramble shrna
    RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding <t>Scr</t> <t>shRNA</t> group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.
    Plko 1 Puro Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pmc12217432-112-78-81?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plko 1 puro scramble shrna - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    93
    Addgene inc 40646 puro shrna scramble roman fernandez
    RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding <t>Scr</t> <t>shRNA</t> group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.
    40646 Puro Shrna Scramble Roman Fernandez, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pm40744015-291-124-123?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    40646 puro shrna scramble roman fernandez - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc virus strains celltag a lentivirus addgene 24591 sh sox9 lentivirus addgene 40646 puro shrna scramble lentivirus addgene 162011 pcmv dr8 2
    RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding <t>Scr</t> <t>shRNA</t> group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.
    Virus Strains Celltag A Lentivirus Addgene 24591 Sh Sox9 Lentivirus Addgene 40646 Puro Shrna Scramble Lentivirus Addgene 162011 Pcmv Dr8 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+plko+1+puro+scramble/pm40744015-290-71-76?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    virus strains celltag a lentivirus addgene 24591 sh sox9 lentivirus addgene 40646 puro shrna scramble lentivirus addgene 162011 pcmv dr8 2 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding Scr shRNA group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.

    Journal: Oncology Letters

    Article Title: BLID is a drug-responsive target of FOXO3a and multi-omics analysis reveals survival mechanisms and therapeutic vulnerabilities in BLID-deficient breast cancer cells

    doi: 10.3892/ol.2025.15155

    Figure Lengend Snippet: RT-qPCR validation of changes in expression of a subset of genes following BLID knockdown. RT-qPCR analysis of several genes in (A) MCF-7 and (B) MDA-MB-231 cells. β-Actin served as the internal control. (A) The y-axis title of the middle graph is identical to the y-axis title of the left graph. (B) The y-axis title of the middle-left graph is identical to the y-axis title of the far-left graph. *P<0.05 and **P<0.01 (BLID shRNA vs. the corresponding Scr shRNA group), n=3. shRNA, short hairpin RNA; Scr, scramble control; Ctl, control; RT-qPCR, reverse transcription-quantitative PCR; BLID, BH-3 like motif containing inducer of cell death.

    Article Snippet: The BLID shRNA constructs used were as follows: Construct 1, shRNA TRCN0000265539 (RefSeq- NM_001001786.1 –656s21c1) forward sequence, 5′-CCGGGGACAGATTTCGCCCATTATTCTCGAGAATAATGGGCGAAATCTGTCCTTTTTG-3′ and reverse sequence, 5′-AATTCAAAAAGGACAGATTTCGCCCATTATTCTCGAGAATAATGGGCGAAATCTGTCC-3′; construct 2, shRNA TRCN0000254449 ( NM_001001786.1 –516s21c1) forward sequence, 5′-CCGGTCTGCCATGAAGCGGAATGTTCTCGAGAACATTCCGCTTCATGGCAGATTTTTG-3′ and reverse sequence, 5′-AATTCAAAAATCTGCCATGAAGCGGAATGTTCTCGAGAACATTCCGCTTCATGGCAGA-3′; construct 3, shRNA TRCN0000254448 (RefSeq- NM_001001786.1 –566s21c1) forward sequence, 5′-CCGGTTTAACCAGGATACAAGTTACCTCGAGGTAACTTGTATCCTGGTTAAATTTTTG-3′ and reverse sequence, 5′-AATTCAAAAATTTAACCAGGATACAAGTTACCTCGAGGTAACTTGTATCCTGGTTAAA-3′; construct 4, shRNA TRCN0000254447 (RefSeq- NM_001001786.1 –387s21c1) forward sequence,5′-CCGGGCCTCTGGCAGTTCCATTTATCTCGAGATAAATGGAACTGCCAGAGGCTTTTTG-3′ and reverse sequence, 5′-AATTCAAAAAGCCTCTGGCAGTTCCATTTATCTCGAGATAAATGGAACTGCCAGAGGC-3′; and construct 5, shRNA TRCN0000254446 (RefSeq- NM_001001786.1 –449s21c1) forward sequence, 5′-CCGGTTCCAACAAAGAACCTATGTTCTCGAGAACATAGGTTCTTTGTTGGAATTTTTG-3′ and reverse sequence, 5′-AATTCAAAAATTCCAACAAAGAACCTATGTTCTCGAGAACATAGGTTCTTTGTTGGAA-3′. pLKO.1-puro scramble shRNA (Addgene: scramble shRNA Sequences; Addgene plasmid# 1864 RRID:Addgene_1864; http://n2t.net/addgene:1864 ) was used as the negative control.

    Techniques: Quantitative RT-PCR, Biomarker Discovery, Expressing, Knockdown, Control, shRNA, Reverse Transcription, Real-time Polymerase Chain Reaction